Евразийский сервер публикаций

Евразийский патент № 036477

   Библиографические данные
(11)036477    (13) B1
(21)201690685

 A ]   B ]   C ]   D ]   E ]   F ]   G ]   H ] 

Текущий раздел:      


Документ опубликован 2020.11.16
Текущий бюллетень: 2020-11  
Все публикации: 036477  
Реестр евразийского патента: 036477  

(22)2014.10.03
(51) C12N 15/113 (2010.01)
A61K 31/7088 (2006.01)
A61K 31/713 (2006.01)
A61P 3/00(2006.01)
(43)A1 2016.07.29 Бюллетень № 07  тит.лист, описание 
(45)B1 2020.11.16 Бюллетень № 11  тит.лист, описание  последовательности 
(31)61/887,288; 61/983,720
(32)2013.10.04; 2014.04.24
(33)US; US
(86)US2014/059160
(87)2015/051318 2015.04.09
(71)ЭЛНИЛЭМ ФАРМАСЬЮТИКАЛЗ, ИНК.; ИКАН СКУЛ ОФ МЕДСИН ЭТ МАУНТ СИНАЙ (US)
(72)Беттенкорт Брайан, Фитцжеральд Кевин, Куэрбс Уилльям, Десник Роберт Дж., Ясуда Макико (US)
(73)ЭЛНИЛЭМ ФАРМАСЬЮТИКАЛЗ, ИНК.; ИКАН СКУЛ ОФ МЕДСИН ЭТ МАУНТ СИНАЙ (US)
(74)Медведев В.Н. (RU)
(54)КОМПОЗИЦИИ И СПОСОБЫ ИНГИБИРОВАНИЯ ЭКСПРЕССИИ ГЕНА ALAS1
   Формула 
(57) 1. Двунитевая рибонуклеиновая кислота (dsRNA) для ингибирования экспрессии синтазы 5'-аминолевулиновой кислоты печени 1 (ALAS1), где упомянутая dsRNA содержит смысловую нить и антисмысловую нить, которая включает участок комплементарности РНК-транскрипту ALAS1 (например, SEQ ID NO:1) и содержит по меньшей мере 20 смежных нуклеотидов последовательности UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) или UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
2. Двунитевая рибонуклеиновая кислота (dsRNA) для ингибирования экспрессии ALAS1, где упомянутая dsRNA содержит смысловую нить и антисмысловую нить, которая включает участок комплементарности РНК-транскрипту ALAS1 (например, SEQ ID NO:1) и содержит по меньшей мере 20 смежных нуклеотидов из (i) антисмысловой последовательности, приведенной в любой из табл. 21-40, или (ii) немодифицированного варианта антисмысловой последовательности, приведенной в любой из табл. 21-40 (SEQ ID NO: 4172-5237).
3. DsRNA по п.2, где упомянутая dsRNA содержит по меньшей мере один модифицированный нуклеотид.
4. DsRNA по любому из предыдущих пунктов, где дуплексный участок составляет 17-23 пары нуклеотидов в длину.
5. DsRNA по любому из предыдущих пунктов, где по меньшей мере одна нить содержит 3'-выступающий конец по меньшей мере из 2 нуклеотидов.
6. DsRNA по любому из предыдущих пунктов, где каждая нить составляет не более 26 нуклеотидов в длину.
7. DsRNA по п.3, где по меньшей мере один модифицированный нуклеотид выбран из 2'-O-метила, 2'-фтор-модифицированного нуклеотида и необязательно одной или нескольких 5'-фосфотиоатных групп или любой их комбинации.
8. DsRNA по любому из предыдущих пунктов, дополнительно содержащая лиганд, при этом лиганд конъюгирован либо с 3'-концом, либо с 5'-концом смысловой нити dsRNA.
9. DsRNA по п.8, где лиганд содержит углевод, при этом лиганд необязательно представляет собой лиганд GalNAc.
10. DsRNA по п.9, где лиганд представляет собой
Zoom in
11. DsRNA по любому из пп.8-10, где лиганд присоединен с помощью двухвалентного или трехвалентного разветвленного линкера.
12. DsRNA по п.11, где лиганд и линкер показаны в формуле XXIV
Zoom in
13. DsRNA по п.8, где dsRNA конъюгирована с лигандом L96 с помощью линкера, как показано ниже
Zoom in
14. DsRNA по любому из пп.8-13, где лиганд нацеливает dsRNA в гепатоциты.
15. DsRNA по любому из предыдущих пунктов, где dsRNA содержит смысловую нить, состоящую из последовательности, выбранной из последовательностей, приведенных в табл. 21-40, и антисмысловой нити, состоящей из последовательности, выбранной из последовательностей, приведенных в табл. 21-40.
16. DsRNA по любому из предыдущих пунктов, где dsRNA характеризуется значением IC50, составляющим менее 1 нМ, менее 0,05 нМ, менее 0,02 нМ или менее 0,01 нМ.
17. DsRNA по любому из предыдущих пунктов, где dsRNA характеризуется разовой дозой ED50, составляющей менее приблизительно 10 мг/кг или менее приблизительно 5 мг/кг.
18. DsRNA по любому из предыдущих пунктов, где смысловая нить содержит последовательность CAGAAAGAGUGUCUCAUCUUA (SEQ ID NO: 4155) или состоит из нее.
19. DsRNA no п.l или 2, где:
(i) антисмысловая нить содержит антисмысловую последовательность AD-60519, где антисмысловая последовательность содержит все модифицированные нуклеотиды из AD-60519;
(ii) антисмысловая нить состоит из антисмысловой последовательности AD-60519, где антисмысловая последовательность содержит все модифицированные нуклеотиды из AD-60519;
(iii) смысловая нить содержит смысловую последовательность AD-60519, где смысловая последовательность содержит все модифицированные нуклеотиды из AD-60519;
(iv) смысловая нить состоит из смысловой последовательности AD-60519, где смысловая последовательность содержит все модифицированные нуклеотиды из AD-60519;
(v) смысловая нить содержит смысловую последовательность AD-60519, а антисмысловая нить содержит антисмысловую последовательность AD-60519, где смысловая и антисмысловая последовательности содержат все модифицированные нуклеотиды из AD-60519, или
(vi) смысловая нить состоит из смысловой последовательности AD-60519, а антисмысловая нить состоит из антисмысловой последовательности AD-60519, где смысловая и антисмысловая последовательности содержат все модифицированные нуклеотиды из AD-60519.
20. DsRNA по п.1 или 2, где:
(i) антисмысловая нить содержит антисмысловую последовательность AD-60489 и/или смысловая нить содержит смысловую последовательность AD-60489, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-60489, или
(ii) антисмысловая нить состоит из антисмысловой последовательности AD-60489 и/или смысловая нить состоит из смысловой последовательности AD-60489, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-60489.
21. DsRNA по п.1 или 2, где:
(i) антисмысловая нить содержит антисмысловую последовательность AD-61193 и/или смысловая нить содержит смысловую последовательность AD-61193, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-61193, или
(ii) антисмысловая нить состоит из антисмысловой последовательности AD-61193 и/или смысловая нить состоит из смысловой последовательности AD-61193, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-61193.
22. DsRNA по п.2, где:
(i) антисмысловая нить содержит антисмысловую последовательность AD-60819 и/или смысловая нить содержит смысловую последовательность AD-60819, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-60819, или
(ii) антисмысловая нить состоит из антисмысловой последовательности AD-60819 и/или смысловая нить состоит из смысловой последовательности AD-60819, где антисмысловая и/или смысловая последовательность содержит все модифицированные нуклеотиды из AD-60819.
23. Двунитевая рибонуклеиновая кислота (dsRNA) для ингибирования экспрессии ALAS1, где упомянутая dsRNA содержит смысловую нить и антисмысловую нить, причем антисмысловая нить включает участок комплементарности РНК-транскрипту ALAS1, причем указанная dsRNA находится в форме конъюгата, имеющего следующую структуру:
Zoom in
или его фармацевтически приемлемой соли,
где Af, Cf, Gf, Uf = 2'F рибонуклеозиды;
Am, Cm, Gm, Um = 2'- OMe рибонуклеозиды;
Zoom in= фосфоротиоат;
Zoom in= фосфодиэфир и
где
Zoom in
24. Клетка, содержащая dsRNA по любому из пп.1-23.
25. Фармацевтическая композиция для ингибирования экспрессии гена ALAS1, при этом композиция содержит dsRNA по любому из пп.1-23.
26. Фармацевтическая композиция по п.25, где dsRNA вводится в безбуферном солевом или водном растворе.
27. Фармацевтическая композиция по п.25 или 26, где упомянутая композиция является пригодной для подкожного введения.
28. Способ ингибирования экспрессии ALAS1 в клетке, при этом способ включает:
(a) введение в клетку dsRNA по любому из пп.1-22 и
(b) поддержание клетки, полученной на стадии (а), в течение времени, достаточного для обеспечения разрушения mRNA-транскрипта гена ALAS1, с ингибированием тем самым экспрессии гена ALAS1 в клетке,
при этом экспрессия ALAS1 необязательно ингибируется по меньшей мере на 20% или по меньшей мере на 30%.
29. Способ снижения уровня порфирина или предшественника порфирина (например, ALA или PBG) в клетке (например, гепатоците), включающий приведение клетки в контакт с dsRNA по любому из пп.1-22 в количестве, эффективном для снижения уровня порфирина или предшественника порфирина в клетке.
30. Способ лечения порфирии, при этом способ включает введение субъекту, нуждающемуся в таком лечении, терапевтически эффективного количества:
(i) dsRNA по любому из пп.1-22 или
(ii) композиции по любому из пп.25-27,
с осуществлением тем самым лечения порфирии.
31. Способ по п.30, где субъектом является субъект с риском развития порфирии или с диагностированной порфирией.
32. Способ по п.30 или 31, где порфирия представляет собой острую перемежающуюся порфирию или порфирию, обусловленную недостаточностью ALA-дегидратазы.
33. Способ по любому из пп.30-32, где:
(i) dsRNA или композицию, содержащую dsRNA, вводят после острого приступа порфирии,
(ii) dsRNA или композицию, содержащую dsRNA, вводят во время острого приступа порфирии или
(iii) dsRNA или композицию, содержащую dsRNA, вводят профилактически для предупреждения острого приступа порфирии.
34. Способ по любому из пп.30-33, где dsRNA вводят в дозе 0,05-50 мг/кг веса тела субъекта, например в дозе 0,01-5 мг/кг веса тела субъекта.
35. Способ по любому из пп.30-34, где с помощью способа:
(i) снижают уровень порфирина или предшественника порфирина (например, 5-аминолевулиновой кислоты (ALA) или порфобилиногена (PBG)) у субъекта, при этом необязательно уровень снижают по меньшей мере на 30%, и/или
(ii) ингибируют экспрессию ALAS1 у субъекта.
36. Способ по любому из пп.30-35, где с помощью упомянутого способа:
(i) облегчают симптом, ассоциированный с нарушением, связанным с ALAS1 (например, порфирией),
(ii) снижают частоту острых приступов симптомов, ассоциированных с порфирией, у субъекта и/или
(iii) снижают вероятность возникновения острых приступов симптомов, ассоциированных с порфирией, у субъекта в случае, когда субъект подвержен воздействию провоцирующего фактора, например предменструальной фазы.
37. Способ по любому из пп.30-36, где dsRNA или композицию, содержащую dsRNA, вводят согласно схеме дозирования, например еженедельно, один раз в две недели или ежемесячно.
38. Способ по любому из пп.30-37, где dsRNA вводят до острого приступа порфирии, например во время продрома.
39. Способ по любому из пп.30-38, где субъект имеет повышенный уровень (например, уровень в плазме или моче) ALA и/или PBG и при этом необязательно субъект испытывает хроническую боль.
40. Способ по любому из пп.30-39, где с помощью способа снижают повышенный уровень ALA и/или PBG.
41. Способ по любому из пп.30-40, где с помощью способа снижают или предупреждают боль, нейропатию и/или повреждение нервов.
42. Способ по любому из пп.30-41, где с помощью способа предупреждают острые приступы порфирии.
43. Способ по любому из пп.30-42, где dsRNA или композицию, содержащую dsRNA, вводят систематически.
44. Способ лечения субъекта с повышенным уровнем ALA и/или PBG, при этом способ включает введение субъекту, нуждающемуся в таком лечении, терапевтически эффективного количества:
(i) dsRNA по любому из пп.1-22 или
(ii) композиции по любому из пп.26-28,
при этом необязательно способ является эффективным для снижения уровня ALA и/или PBG.
45. Способ лечения субъекта с повышенным уровнем ALA и/или PBG, при этом способ включает введение dsRNA по любому из пп.1-23 по 1, 2,5 или 5 мг/кг один раз в неделю в течение по меньшей мере десяти недель со снижением тем самым уровня ALA и/или PBG у упомянутого субъекта.
46. Способ лечения пациента-человека с AIP, который испытывал несколько рецидивирующих приступов, при этом способ включает введение dsRNA по любому из пп.1-22 в дозе 2,5 мг/кг в течение по меньшей мере 6 месяцев с осуществлением тем самым лечения упомянутого пациента, при этом необязательно с помощью упомянутого способа:
(i) снижают частоту приступов,
(ii) сокращают применение гематина,
(iii) снижают риск госпитализации и/или
(iv) повышают качество жизни.
47. Способ анализа уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта, при этом упомянутый способ включает выявление (например, измерение) уровня mRNA ALAS1 в образце биологической жидкости (например, образце крови, образце плазмы, образце сыворотки или образце мочи) от субъекта, при этом упомянутый образец биологической жидкости содержит mRNA ALAS1, с осуществлением тем самым анализа уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта.
48. Способ анализа уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта, при этом упомянутый способ включает:
(i) получение РНК (например, внеклеточной РНК) из образца биологической жидкости (например, образца крови, образца плазмы, образца сыворотки или образца мочи) от субъекта, при этом упомянутый образец биологической жидкости содержит mRNA ALAS1;
(ii) получение cDNA ALAS1 с mRNA ALAS1;
(iii) приведение в контакт cDNA ALAS1 с нуклеиновой кислотой, комплементарной (например, зондом и/или праймером) cDNA ALAS1 или ее части, с получением тем самым реакционной смеси, и
(iv) выявление (например, измерение) уровня cDNA ALAS1 в реакционной смеси, где уровень cDNA ALAS1 указывает на уровень mRNA ALAS1,
с осуществлением тем самым анализа уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта.
49. Способ по п.48, причем:
(a) способ включает PCR, qPCR или 5'-RACE,
(b) нуклеиновая кислота представляет собой зонд или праймер и/или
(c) нуклеиновая кислота содержит выявляемый фрагмент, а уровень mRNA ALAS1 определяют посредством выявления количества выявляемого фрагмента.
50. Способ по п.49, где эффективность лечения порфирии оценивают на основании сравнения уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта с нормальным значением.
51. Способ по п.49, где снижение уровня циркулирующей внеклеточной mRNA ALAS1 у субъекта в ответ на лечение порфирии относительно нормального значения указывает на то, что лечение порфирии является эффективным.
52. Способ по любому из пп.49-51, дополнительно включающий получение образца биологической жидкости от субъекта.
53. Способ по п.52, в котором образец биологической жидкости является отделенным от ткани и при этом образец биологической жидкости содержит экзосомы.
54. Композиция, содержащая dsRNA по п.19 и воду для инъекции.
55. Композиция по п.54, содержащая приблизительно 200 мг/мл dsRNA по п.20.
56. Композиция по п.54 или 55, где композиция характеризуется значением рН 6,0-7,5.
57. Композиция по любому из пп.54-56, где композиция составлена для подкожной инъекции.
58. Способ лечения субъекта с порфирией (например, AIP) или повышенным уровнем ALA и/или PBG, при этом способ включает подкожное введение субъекту композиции по любому из пп.53-56.
59. Способ по п.58, где композицию вводят в дозе 0-5 мг/кг, например в дозе 2,5 мг/кг или менее или в дозе 1-2,5 мг/кг.
60. Способ по п.59, где композицию вводят еженедельно.
61. DsRNA по п.1 или 2 или фармацевтическая композиция по п.25 для применения в лечении порфирии у пациента, причем порфирия необязательно представляет собой печеночную порфирию или острую перемежающуюся порфирию (AIP), причем порфирия необязательно представляет собой острую печеночную порфирию.